Semikonservativ DNA-replikationsproces: Trin og detaljerede fakta

DNA-replikation er en proces, hvor DNA'et laver sine egne kopier eller dublerer sig selv under processen med deling af celler. Denne DNA-replikation er en semikonservativ proces.

Hvad er det semikonservative DNA-replikation proces, og hvad er de trin, der er involveret i den. Det DNA-replikation proces omfatter initiering, forlængelse og afslutning. Det starter fra genkendelsen af ​​replikationsstedet og inkluderer forskellige trin og afslutter det ved at forbinde DNA-fragmentmolekylerne.

Denne artikel vil fokusere på de detaljerede oplysninger om hver eneste del af DNA-replikation proces.

Så vi kender det DNA er et genetisk materiale, som bærer genetisk information og går fra en generation til en anden.

DNA er et dobbeltstrenget organisk molekyle bestående af en pentose sukker molekyle, phosphat molekyle og 4 nitrogenholdige baser parret. Adenin parrer sig med thymin og cytosin med guanin.

Hvert af disse molekyler har de gener, der koder for a specifik aminosyre og give den genetiske information.

Semikonservativ DNA-replikationsproces
Semikonservativ DNA-replikationsproces
Billedkreditter- Wikimedia

Hvad er en semikonservativ DNA-replikationsproces?

Vi ved, at DNA-replikation er en proces, hvor 1 streng replikerer sig selv og laver kopier ud af den.

DNA er en dobbeltstreng og har en nitrogenholdig base (A, T, G, C), et pentosesukkermolekyle - Deoxyribosesukker, et meget negativt fosfatmolekyle. Så under replikation af den indledende DNA-streng bibeholdes en streng, og den anden streng laves ved at tilføje de specifikke nukleotider til den.

Så den ene er nydannet streng af DNA (Tilføjelse af nukleotider) og den anden streng er beholdt gammelt DNA streng som kaldes skabelonstreng.

Eksempel: Skabelonstrengen af ​​DNA er

ATTGCATAGGGGCCTTTAACC TGG CATAGGTTTAAACCCGGGG AGGGGCCTTTAACCTGG CATAGG

Den nydannede komplementære DNA-streng vil være

TAACGTATCCCCGGAAATTGG ACCGTATCCAAATTTGGGCCC C TCCCCGGAAATTGGACCGTAT CC

DNA-replikation fra 3 til 5 prime 13061371753 1
Replikationsproces
Billedkreditter- Wikimedia

Læs mere om Er cyanobakterier encellede eller flercellede: hvorfor, hvordan og detaljerede indsigter

Hvad er trinene i den semikonservative DNA-replikationsproces?

Den semikonservative DNA-replikationsprocessen omfatter 3 trin.

Indledning:

  • Dette er den proces, hvor DNA-replikationen starter eller starter.
  • Enzymet kaldet helicase, der er ansvarlig for genkendelsen af OriC– Replikationsorigin binder til DNA-strengen og afvikler eller adskiller det dobbeltstrengede DNA-molekyle.
  • slutprodukt af trinnet/stadiet/fasen er de 2 strenge af dobbeltstrenget DNA bliver til 2 separate DNA-strenge, men ikke helt.
  • Halvdelen af ​​strengen forbliver som den dobbelte streng, da de ikke deltager i det positive øjeblik, hvilket giver en gaffellignende struktur kaldet replikationsgaffel.

Læs mere om Er svampe flercellede eller encellede: hvorfor, hvordan og detaljerede indsigter og fakta

Biologisk informationsstrøm i molekylærbiologiens centrale dogme
Replikationsgaffel
Billedkreditter- Wikimedia

forlængelse:

  • Tilsætning af RNA-nukleotider ved at primeren foregår her til template-DNA-strengen.
  • Et andet enzym kaldet Primase producerer en lille streng af RNA, som det næste enzym identificerer og binder til.
  • 3' til 5' retningen af ​​strengen kaldes førende streng.
  • 5' til 3' retningen af ​​strengen kaldes haltende streng.
  • Denne tilføjelse af nukleotider udføres af et specifikt enzym kaldet DNA -polymerase som tilføjer nukleotidet, der komplementerer template-DNA'et.
  • DNA -polymerase ikke har kapacitet til producere or syntetisere en ny streng, den kan kun tilføje til en allerede eksisterende streng.
  • Endelig RNA-nukleotider vil blive erstattet af DNA-nukleotider af enzymer kaldet exonukleaser FEN1 og RNase H.
  • Så når adenin er til stede, tilsættes thymin og guanin er til stede, cytosin tilsættes- omvendt.

Opsigelse:

  • Nu skal syntesen af ​​nye tråde stoppe på et tidspunkt. Når termineringspunktet er nået, stopper DNA-polymerasen tilsætningen af ​​nukleotider.
  • DNA-polymerasen har ikke evnen til at skabe en binding imellem til kombinerer den.
  • Enzymet ligase kombinerer strengen ved skabe en phospho-di-esterbinding ind i DNA-molekylet, således at strenge bliver kombineret.
bubbke
DNA-replikationsproces
Billedkreditter- Wikimedia

Læs mere om Adenosin - nukleosid og nukleosidphosphoramidit Oversigt over vigtige aspekter

Sammenfatning af trin i den semikonservative DNA-replikation behandle:

De faktiske og velkendte trin i semikonservativ DNA-replikation er initiering, forlængelse, afslutningsprocessen. Den meget mere forenklede version er

  • Anerkendelse af replikationsstedet eller -originet
  • dissociation eller afvikling af DNA-strenge.
  • Tilsætning af nukleotiderne
  • Syntese af en ny DNA-streng
  • Opsigelse af synteseprocessen
  • Ved at kombinere af strengene ved enzymatisk proces

Læs mere om Biosyntese af puriner og pyrimidiner En vigtig del af cellulær metabolisme

Så 1 dobbeltstreng af DNA bliver til 2 dobbeltstrengede DNA-molekyler. Hver streng har 1 skabelon og en nysyntetiseret dna, der komplementerer skabelon-DNA'et.

Semikonservativ replikation af DNA 13081032424
Semikonservativ DNA-replikation Proces
Billedkreditter- Wikimedia

Læs mere om Reparation af nukleotidudskæring og polymorfisme med enkelt nukleotid | En vigtig diskussion

Hvad er de enzymer, der er ansvarlige for den semikonservative DNA-replikation behandle?

  • DNA Helicase enzym – DNA Helicase hjælper med at afvikle det dobbeltstrengede DNA.
  • Primase enzym – Tilføjelse af en kort RNA-primer
  • DNA polymerase enzym – Tilføjelse af de nye nukleotider
  • Exonucleases Enzyme FEN1 Enzyme og RNase H Enzyme – Fjernelse af de oprindeligt dannede RNA-nukleotider.
  • Enzym Ligase– Kombiner de 2 separate DNA-strenge til én, hvilket gør det dobbeltstrenget DNA.

Læs også: